If You Have COVID19 - This is The Cure Holden Hill, South Australia, Australia
By Dr Freddo on 11-Dec-20. Waypoint GC93PYX

Today, I hike the dry Creek Trail from the prison, out to near the Westfield mall. Then I walked back home, using a rather circuitous route.Anyway, I saw this one last night, and added it to todays schedule. No problems, finding the container.

Would be a bit embarassing if I couldn't work that one out.GZ is very busy. But you've just got to get on with it.TFTC

TCGACTGAGCCA OAACGAA GGCGAAACC TGCOGTGATTGATTCCACTGAGCCC ACCTGGO TCCCCCGAGAACGAC GCT TGGGAGGAAAAG OTTTTTT TGGOAGAAAATCGACGGAGCCA ACTCATCGTGAAGAG TCCOCTCGTAGAA CCTUGAAGAGCTAGAGAGT TGGCACATATTGAGCACC OTTCTTC TGGOCGAAAAAGCACTGAGCCG TTTOUCGA GATATCAGTTGTOGTGGAACGA ACACATGAG TGCUAGAGAG TTTOCGA TGCOGTGATCGATTCTACGGAGCCG TTCATCGTTGAA TCGOCTAGTAGAA ACTCACGAA TGTUCGCGAA TTCOAGG TGTOGTTATCGACTCTACCGAACCT TCGATCX GGCGAAACT CGCGAACTTGAAGCTTCCGAGGAC TTTAGGOATG TGTOGTCATCGAT JGCAATCTTGAGTACGGAACCG TCGGAAGTGGAGAAC GGGO GCGAATGAC TTTATTAACGAT ACACACGAG TGCUCGCGAA TTTOCGC TGTOGTCATTGACTCCACGGAGCCT GAGATTGGGCATACT TCTATCGGAAAC CTAOGGTTCTACTGAACCG AATATCAATGAA ACCTTCACTTGT GATAGG TTTCGCGAAGACGATO

I tried the puzzle long time ago, but not successful.
Back in February last year, I got a hint from CO, and that's the key to solve the puzzle.
Got the final co-ordinates in the to-find list, for about one year, until I got an opportunity to visit GZ.
At GZ, cache has been found in the first place I checked.
Signed the log book, and put the cache back. Wish no one noticed me.
Thanks for the puzzle and the cache, Dr Freddo.

After being intimidated by the wall of text, I went to look for patterns and after much searching, I found one.

Find #159
TFTC and the puzzle Dr Freddo

A fun puzzle to solve and today I needed a pick-me-up so the Doctor prescribed a Geocache.
Quick find in the likely spot.

Thanks for the cache Dr Freddo.
# # #11969 # #

Blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah I found your hidden message blah blah blah blah blah blah blah blah blah blah and I found your cache. Clearly a sign of the times Dr Freddo.

I am not sure finding a cache is a cure,
it seems to make me want to find more,
Thanks for the puzzle to test my mind,
Added it to the list, another nice find.

I looked at this and thought "Bloody hell", I can't do this. But by chance I looked down the bottom and saw it.
TFTC Feddo
Striker and Runningman222.

Another adventure in the big smoke with Mattycat mainly northern and northeastern areas today , a great day and only one DNF and bonus lab adventure done, not sure if we have the cure but we did get the solution but now we need to go to spec savers
TFTC Freddo

When we first looked at this we wondered "What the heck?" but then recalled a similar style of puzzle. That lead to a quick decoding of the gene sequence to get the final coordinates. Today we went to look for the cache, Accurate coordinates led to a quick find. The cache and contents were in good condition. Thanks Freddo for an enjoyable cache - it earns a favourite from us.

Out caching with Earthlight.
Tftc

No idea how to start on this puzzle until chatting with a friend. Driving by today so stopped to locate. Cache all ok.TFTC

I had almost all of March away from caching to concentrate on the Garden. Time to get back to working towards my goals for the year. Also Time to get back into the regular Wednesday Wandering again. [^] Today myself, Blackadders and S.A. Sewer Rats headed out on a BFE rampage. Last puzzle meeting night we had worked on all the new BFE puzzles and decided it was high time to go and find them all - and his multi caches, trads and even the lab cache series. The other two having already found some whilst I was in the garden completed all that was required to get the Rat to TBFEN. Unfortunately we didn't have time to revisit 3 so I could get there and an early DNF on a BFE meant that would be impossible anyway. I ended up with 3 DNF's today - so much for goal number 3!

I looked at the puzzle and it was just ***A Forest***. So I wrote ***A letter to Elise*** for help. There, there ***Boys Don't Cry*** and helped me solve the puzzle. If this was ***Friday I'm in Love*** but it wasn't it was one of those ***Inbetween Days***. I settled for looking for the cache which I found on ***Fascination Street***. That certainly fitted in with ***The Plan For Today***.

Only one of the three goals from last year achieved. So once again trying and fill my calendar with multi-caches and complete loop 11 again this year. [^] For my third goal I will try and get my DNF numbers to single digits. That should keep me busy again this year! [:o)]

***Thanks Freddo for putting out this cache and maintaining it for our enjoyment. ***
Logs prepared and published through GSAK.

A cure for an anxious friend is spending time with her. Found as I head home.

TFTC Dr Freddo

Today I needed to find a multi cache so after work I decided to drive to Tea Tree Plaza and the Northern Suburbs to find some BFE and Freddo caches.
Ended up with 8 finds for the evening and a nice walk along the O Bahn path. A couple of deja vu caches were found.
Wow that was a hard puzzle to do on the phone for a D1.5, got there in the end. TFTC Freddo

A bit if DNA and a bit if Covid what more do you want out of a puzzle in the current world we live in

This morning I set out to go for a 5km loop walk around morialta to collect the last reaming caches in the area. Before and after I stopped at a few stray caches along the way.
Total 11 finds for the day.

Thanks for the cache

This one had been solved soon after publishing and there it stayed in my to be found pile. [^]

Today after an early morning brekky event not too far away I decided to come here and make the find and put my stamp in the log.

Cache was found in the first place I looked which is always good.

Thanks for the puzzle and cache Dr Freddo.

Rex and I headed into Victoria Park to attend the Take me to the April sun in... Dayboro! event[^]
We rang, then picked up LiB on the way [^]
Stayed for the yummy lunch of unpricked sausages and all the chatting[^]
After the event ended, I sought some company to go find a cache that I had been to about 4 times prior to my going to Victoria. So with the esteemed company of GPS, ozmilo, SpidermonkeysMum and LiB we all headed off towards a not so basic binary cache[^]
Suffice to say, it was a DNF
Rex and I then drove LiB home[^][^] andfollowing that we found 1 cache on our roundabout route home
1 event attended and 1 cache for the day with 1 DNF too

That COVID-19 really has played havoc with geocaching so it's nice to know that there is a cure
The cure was found after an interesting journey through backstreets that I have not been into for many years[^]

TNLN. SL. TFTC Freddo

Nice day to be out & about in the suburbs doing a spot of caching with CPwanderer & clare007...
This was the last for the day...
Surely there will be a cure or The Cure
TFTC Freddo

Last find on a short run with clare007 and hevwalker!!!! Thanks Freddo for the advenrure!!

I had some time to fill in this afternoon while I was having some work done to my car, so I went for a walk around Windsor Gardens, finding this cache along the way. I didn’t have a pen, but fortunately I was able to borrow one from a nearby business. Thanks Freddo for the puzzle and the cache.

Found during a caching tour of the northern suburbs. Thanks for the puzzle and cache Freddo!

With the weather so good it would have been a shame to stay home and do not much today. So jumped into the car and headed out to the north eastern suburbs. All up 18 caches were found, 2 DNF and one was given away as the area looked to "snakey" for my liking. All caches were in pretty good condition. No Covid test needed to solve this one. TFTC to all COs.

Puzzle was quickly solved, sadly the same can't be said of trying to find the cache.

Took a couple of sweeps to locate it.

TFTC

Well we made it to the end of 2020 and had a couple of little caching goals to round off [:o)]

Purrfect Di said let's go caching straight after work... that's why she's perfect

So off we went, over the hills, and thataway...

We came across your cache Freddo , and it gave us joy this New Year's Eve.

Caching seemed so much safer than mixing it up with the crowds

An excellent puzzle to sum up #2020 and enter #2020won !

I masked up all year! Had some close contacts, but tests say I survived. Got the t-shirt. Fun year.
Happy end to the year of the nurse and midwife !

PS if the real cure came in one of those tins I'd rather die ! ! ! Damn mint tins, blow up the mint factory...

- - - - - - -

Happy 7th distanced day of Christmas! Avoid germs - avoid people - cache the regions !


Bring on #2020won A Happy New Year ahead. But still not much has changed really so take care

I am currently on my L-plates and wanted to get some hours up. Today was a perfect day for a big 6h drive mainly on the North Eastern side of the city. Lots of opportunities for parking practise, reversing, u-turns and finding a few of those mystery caches that my dad had solved throughout the year but never collected. Total tally was 18 caches visited and 18 caches found. Most caches were stamped with my dad’s stamp but when there was a pencil available he also added my name.
Thank you to all Cache owners

Our geodaughter Skyebird3 is on her L-plates and wanted to get some hours up. Today was a perfect day for a big 6h drive mainly on the North Eastern side of the city. Lots of opportunities for parking practice, reversing, u-turns and finding a few of those mystery caches that had been solved throughout the year but never collected. Today’s total tally was 18 caches visited and 18 caches found.

Cache #7 and time for a McDonald’s pit stop. The local Shell station did not have a toilet but it did have a cache nearby.
Nothing wrong with my eyes as the nasty puzzle was quickly recognised and the solution took all of 2 minutes to obtain!
Tftc Robert Smith

Found It!
Pretty sure I don't have COVID19. I haven't been to Victoria in 2020. This puzzle turned out to be quite a bit harder than it should've been. After some hints I managed to work it out. Then a quick find today while passing by GZ.
TFTC

It's Christmas day.
I've got myself a case of Corona.
I'll be feeling very average tomorrow.
TFTC.

Tried several things before spotting something odd on gthe cache page.
Got the green tick.
A quick find on way home from elsewhere. Tftc

Touch wood there is no nasty Covid in the Adder family. Thankyou for the cache and puzzle Dr Freddo found 23 December 2020 15:38

Puzzle solved quickly. GZ was another matter. I looked and I looked and I felt and I felt. And the spiders crawled on my hands, but I kept searching for a while longer. A quick PAF sent me to a spot I had looked at before, but obviously not well enough. Doh! PS #NLAMT.

Thanks for the cache Freddo.
Found on 22/12/20 at 18:51.
Find #12336.

I coughed a few times and started to sweat. I didn’t need to line up to find the cache.
TFTC from ImSue

Idid not inhale.

Thanks to Freddo and **clear skies** from TeamAstro. [^] Cache the planet! [^]

Well the proteins lined up for a quick solve last night, and enough time for a quick find this morn.
That's the podium completed.
TNLNSL
Thanks

Actually I am pretty sure that is actually the virus genome albeit a somewhat mutated variant. But either way I don’t think I’m keen to try and feed that sequence into our 3D printer.
Of course it is irrelevant that you might be FTS when Bob is in full BFE mode. Because he bypasses the puzzle and solution and just goes straight to get the cache. We admit to having done this ourselves a few times but it is always impressive to see the speed of the master.
Thanks again for the “easy” puzzle Freddo. Please stick to the D3 and higher ones because we can solve those. The lower D ones are just too difficult to grasp.

Owl was having lunch at her aunt's place and then had a couple of hours to kill before an appointment. Fortunately there was a cache just around the corner and this started a series of jumps to the appointment. This puzzle was solved reasonably easily. You have to be lucky when an incorrect solution gives you a glimpse into the correct one. Sneaky Mr Frog! But a quick find today was just what the doctor ordered.

Veni. Vidi. Vici. Scripsi.
Saw this published yesterday, but was at the celebration event and FTF went pretty quickly. So when I got home I had a look and started to try all the usual Dr Freddo tricks, but the brain kept screaming it is only a D1.5 so stop overthinking it. Tried a different approach and suddenly something popped up and the solution quickly revealed itself and the solution checker agreed with my numbers. Phew. Being not too far from home I decided that this would be the target on the way to work in the morning.
This morning I was working in the field but two critical things had to be done, and this one was the first. Drove to the area and parked nearby and wandered towards GZ and picked the hide location as I wandered up. Got to GZ and located the cache in the first place I looked. Gotta love that. Stamped the log and replaced. Signing duties done it was time for teh second thisng and I knoew I was going to be the tardy mouse, but I did not care as this mouse got the silver cheese.
Gratias pro cache Dr Freddo

Well we made that solve a lot harder than it needed to be!

Published

Find 3174
Solved BFE Style.
Found BFE Style. Without the GPS.
Logged BFE Style.

It's Fine Elsewhere