The Meaning of Liff Mile End, South Australia, Australia
By XY Freddo on 22-May-07. Waypoint GC1336Q

DNF

Caught up with weredunn4 yesterday for my birthday lunch and he compromised me for a day of geocaching today Apparently Mrs weredunn4 wanted him out of the house for the day, so a leave pass was granted So here we are, with WayneAPN in the Northern suburbs picking off a few cachesThis cache was quickly found a log stamped.after a previous DNF here, it was nice to turn this into a smiley TFTC

Call from Weredunn4 last night, for a few targeted caches today. This being one of them.Teamed up with cheezel1961 and hit the road around the northern area of Adelaide. TFTC SL

Fortunately an elevation device was already here. Cache found and log signed

Here's one to find today.Thank you for placing the cache Freddo.

Got some help from a PAF in relation to how to gain the coordinates and then after some wandering around at GZ I was able to use my surroundings effectively to find the cache!Signed and returned. Great hide!TFTP!

Found a website to decode the genetic string, along with the hint and solved this back in November I was in the area today after work to look for a couple of ether caches so called by this one.Hunted around on the upper level and found nothing so moved down. Checked underneath where I was and nothing there. Then went down further to check, but needed some elevation (which I didnt have with me) to get high enough to check..another visit needed here I think

Found with sir_spectre while heading to the other side of Adelaide for a CITO.
Thanks for the fun

2nd time here. First time i tried to jetski the location and was on the " wrong side ". Asked a puzzler for help and got sent a web site to decode the puzzle. Quick find this time after decoding the hint and looking on the other side. Also found in the rain.
Out with Mogni to get a few more puzzle since in a recent trip over the border to Victoria we stamped a challenege cache. Also grabbing a few multi's to get me closer to 1000 multi's, about 50 to go. Plus a side trip to IKEA ( for pencils ) and mogni bought something there as well. We also stopped to get one of the top 20 favourited caches in south australia.

Like many puzzle caches, I start with research into the subject, and as usual, I learned a lot. I was comfortable being on the right track with the research results, but how to make those letters pay. I googled plenty, got lots of ideas, and even found a beauty for an alternative puzzle, but had no luck in finding some good numbers. The results did not answer my needs.

I reached out and got some info back. The CO’s info was a little more cryptic than usual, but I had already achieved that stage of the puzzle. Some info came to me from another direction. Well there you go, that’s something I never imagined would exist. I wonder how one finds these things, but I did not ask. The final made sense, a perfect hide location for the frog, and one I am sure he will master well.

This morning I headed to work and stopped by for a quick grab, only to find GZ was not that easily accessible, at least from the comfort of the bike saddle and timber deck. I did not allow the time required for this. Perhaps the CO had his T2 upside down, it does not add up. I left it and went to work, researching a little more, reading a few logs, and then knew the task at hand.

Home early, I checked the right TOTT was in the car and ventured out. I carried the TOTT all the way around, and noticed the colour of the water here, despite good flows at the moment it does not answer why it is so black looking. I deployed the TOTT right where the hint said, but no bananas. You guessed it, I was on the wrong side of it, how many times do I turn right when I should turn left?

The super thick log book was stamped and returned as found. So glad the pigeons have not made off with it. Nice work XY Freddo, the cache is in good condition, good containers do not age, and has a solid grasp on the item it sits. All round, a nice puzzle, one I doubt I would have resolved without a nudge. Find #7630

After uni this morning had a bit of time to kill so went for a nice walk along the river.
I solved this puzzle ages ago and have never managed to get to GZ, arrived today and then released that I forgot a TOTT luckily I found some rubbish nearby that allowed me to get up and access the cache. The cache is looking a bit old but is still in good condition and is all good.
Thanks for the cache

Veni. Vidi. Vici. Scripsi
Well, it seems like most others I also needed a nudge to get properly started on this one. I knew immediately on looking at the puzzle what was required, but finding the correct tool (amongst the plethora of ones available), to give a meaningful result proved to be the elusive element. In the end I approached the amphibian and asked a question. In turn I got back another question. Which, it turns out, provided the base on which the solution finally dropped out. So into the TBF queue til the right moment.
This morning I packed the car with the additional TOTT required for this cache and headed off. Had already planned the approach which eventuated exactly as planned. Wandered about 80m to the cache location and on using the TOTT located the cache in the first place I looked. No real prizes for that though. There was really only one place it could be.
Stamped the log and replaced the lot in its hide.
I now know the Meaning of Liff.
Gratias pro cache XY Freddo

This was the target cache for the afternoon with JJ52. Luckily for me JJ52 had passed on a tip on how to solve this one. Once I had done one or two things the coordinates eventually spat out. Won’t have to look at that spinning dna again until the next one .
So we got the tram back to my car parked as close as we could then carted our ladder over the tram tracks to GZ.
Only had to go up the ladder twice and then had the nice big cache in hand. There was a ginormous pile of pigeon poo right next to the cache and more on the cache which made for a delightful assault on the nasal passage.
We both signed the log and then a quick shimmy back up the ladder to replace.
TFTC and the clever puzzle Damn Freddo

Today was a great caching day, 3 events and 6 different cache types found. Even though it started off really cold, by the middle of the day the sun was shining and it was lovely being out and about. [^]

After attending the second event in the city Michells&hound and I filled in a bit of time before the next event finding a Wherigo in the nearby library, then back to the car and finding a parking spot to tackle this one.

This puzzle has sat in my solved folder for 3 years and I have been past GZ on numerous occasions but never with time or the tools to go and make the retrieval.

I remember needing a hint on how to to make some sense of the "original genetic random access memory" and after lots of googling I found what was needed....something else I didn't know much about.

So we got the ladder and crossed the busy road and walked towards GZ. Using the hint to narrow down the possibilities the nice sized cache was found on the second ascent of the ladder and our names stamped in the gigantic log book.

Thanks for the puzzle and cache XY Freddo, I'm glad to have converted this one to Found It.

This puzzle had me stumped like varius other DNA puzzles I had seen around the greater Adelaide area. I just hadn't been taught the solving method yet. However it took an opportunity with the CO to pinpoint the needed hint in the description to then work out how to get the coordinates. Clever indeed, and certainly another solving tool to add to the arsenal.

Rode my bike after work in trying to grab a target cache in the area. Following that unsuccessful DNF, I was going past this cache, and had been reading about the lack of success and tools that were being needed. I saw where the coordinates had it, and sort of had a hunch to where the cache was likely located, so found a side path in taking me to GZ at the right level. I also managed to use the hint well and so had a likely location for the cache. Using my trusty bike, I managed to gain visual sight of the cache, and so was then extracted from its location. A D2/T2 is probably on the low side for this one, but perhaps these were graded at a time when both metrics were out of three? Otherwise a nice cache indeed, thanks Freddo.

My first true Wednesday wandering with the group and what a wander it was.

Getting my name in the logbook for this cache was a case of convenience as we were in the neighbourhood and there was a ladder in the car. It's nice to have this cache on the smilie list now.

Thanks for the puzzle and cache XY Freddo.

Despite our best efforts, we could not find anything here today.

With that being said, we were on a quest for big numbers, and so did not always spend the time searching that we may otherwise have committed, so the cache may actually be still here.

Oh well, there is always next time!

After a great Pi Day of caching around Bobland three days earlier AnyMules and I planned to come cache out the area around the Bobdome. Having stumbled with the latest BFE at Pi night we had since seen the error of our ways and this was put on the list. Of course Mrs. SA Sewer Rat wanted to come and achieve Reel Nirvana again. Doctor Owl just wanted some exercise. So the four of us decided to meet at the Owlery for a fabulous day of BFE cache hunting. That done it was time to go an get some other puzzles that we had worked on together as Puzzled Puzzler meetings.
The group took pity on me and suggested I take a portable elevation device with. I complied. just as well i did. Even when deplaoyed said device and attaining the required altitude the cache was still hard to spot in the darkness of the hide. But find it I did and now my stamp is also in the log.
Thanks Freddo

No luck here for us today.

Needed a cache for the day to keep the streak going. This one was selected as a candidate after helping some others with caches I had already found. A quick walk down to GZ, scaled the ladder twice and spotted the container. 20/9/16, 10:40 pm Find #2810

After attending the GSAK event it was decided that a small group would go caching.
This was our third one on the list.
I had worked this one out sometime ago.
The Blackadders, SA Sewer Rats, and Anymules met at a parking destination.
A quick stroll, scale the leg extension to finally find this cursed cache.
Nice to help Anymules to keep his streak going.
Blackadders was elected to use the leg extensions to reach the cache, but to no avail.
So Anymules had go and found the cache. YAY Happy dance!!
With the log book signed Mr Snake replaced the cache. TFTC

After 2 previous unsuccessful visits, one with an appropriate extendable thing, It was third time lucky. After getting a slight hint to exactly where it was the snake was still blind. Searching there, yes that is where it is, the CO said so. Hmmm. With Anymules taking over the search it was quickly found, Oh there said the Snake. Der. A log signed and replacement removed another smiley gained. Thanks again Mr Freddo.

Lunchtime stroll. Cache in position and intact. All good.

When I first looked at this puzzle I knew what the code was. However as I have no voluntary control over either my RNA polymerase or my ribosomes I was unable to decode it. I went elsewhere to find other puzzles.

After finding and solving a similar puzzle I recalled this one and returned to the page. Now I did have the necessary tools to make discover the meaning of liff.

Armed with a set of coordinates and a decoded hint I headed for GZ. When I arrived at GZ it was clear that I was under-resourced in the leg length department. I blame my parents. DNF. I went away.

Returning today, as I set up my leg extender, I was shaking my head at the concept of a CO who would only give this area 2 terrain stars. Having carefully elevated myself I searched the correctly numbered location but no sign of the prize. After extending the search I still could not find it. Doesn't it always happen when you are in a hurry to be somewhere and just make a "quick" stop?

I decided to ring the CO but he was busy with his morning Weeties and the call went to voicemail. My message was something like "Hi, It's Brad. I'm at GZ for the Meaning of Liff and have elevated myself. I can't find the cache so either I am not looking in the correct place or...... I am not looking in the correct place." I hung up and contemplated my words. Could it be possible that I was not looking in the correct place?

What's around that corner? Not surprisingly there are more spots that could fit the hint.
Upsadaisy.
And lookie there's a cache....
Doh!

A very nice cache too with an excellent logbook which has room for roughly the first 2,000,000 finders to sign before it will need replacing

TNLNSL
TFTC yet again Freddo - and thank you also for returning my call and checking GZ to see if I was still there on your way past

Geocaching 101. Just after "Don't overthink the puzzle" is "Read the logs"
At GZ with legs that are too short one end. Fail.
I will be back.

I solved this puzzle earlier this year, after lots of frustration before that light bulb moment came. Turned out that I forgot a lot in biology classes (I still highly doubt that, but husband said the key to this puzzle is very obvious, and I got it totally wrong when I was in that dead end...)

I went by the location once, and couldn't find the cache. Gathering from the previous logs, some special tools are needed, so I decided to come again when husband is available.

We came to find this cache today, on public holiday. Signal was not too good at GZ, so we had to guess. I thought I saw the container at a likely spot, but husband thought it's not. Milk crate couldn't help either. I really want to find this one, after all the hard work I put in solving it, so I tried an onsite tool, but couldn't confirm if that's the cache. I found another better tool, and husband wielded it. It moved! And something about it let me believe more and more that it's a cache. Finally we got it down, signed, and hurled it back. Really, only a T2??? That's really not right.

Thanks for the cache, Freddo.

We discovered that this raccoon isn't a very good "liff"ter (hehe) of chickens at this cache. Also that the cache is attached in a pretty serious way.
A quick find and sign once we sorted ourselves out.. though I think we may have walked away with the pen (it's worth the next finder bringing one along incase)
TFTC Freddo

Found with Bek-theraccoon. I've certainly had easier T2 caches in my time! had to practice some lifting techniques to get the raccoon to scurry up and grab the cache. The chicken tried to replace it but couldn't get the wings flapping hard enough to take flight, raccoon had to replace. TFTC

Catching up on lots of logging.
Found while out caching with Mattycat.
TFTC

After wasting too much time with the number 42 and previously coming to gz quite unprepared for liff,
returned with small geoson Sebastbat, who tried balancing on me to reach the stars...
This failed of course, but he did spot what we were after at the end of our caching universe
so a tool was sought out. After much poking, liff was retrieved and signed.
Attempts to reach orbit resulted in the cache's safe return.
Glad we d'nat have to do that again
tftc Freddo

M cracked the code and set waypoint, but no cache found… yet…

It took a while to find the right tool to tackle this puzzle but once we had the tool, the solution came quickly. Today we went to look for the cache. We quickly identified the area but only after considerable peering we thought we saw something. Being well out of reach, we scoured the immediate area for an appropriate tool. This proved really useful for retrieving and replacing teh cache container. The cache and contents were in good condition. Thanks for an interesting puzzle Freddo and thanks for the challenging hide.

Woo Hoo! [^]
Luckily today no KELLING was needed. I used my skateboard to get me up to the right level.
I even got back down without an AMPUS. I decided to celebrate the find with a GARVOCK, which made a nice echo at GZ.

Thanks for the Damn Puzzle Freddo.
Find #989

Gotcha!

I found this cache to be a complete BABWORTH.

I wished a BAUGHURST would visit the CO.

But after experiencing something akin to DULEEK, the LOWER PEOVER became apparent.

However, at GZ, I realised that I did not bring my BOTUSFLEMING. What was I to do?

But then I found the remnants of a game of PELUTHO and all was well.

This made me give a little EWELME

Thanks Freddo

ZZzz..

CACHING Member - Cachers Against Canned Hunting In Nomadic Groups

I've had the solution to this for a couple of years now, but never been in the area to use them. With my wife for support I was finally able to attempt this (I suspected from the logs that it wasn't that easy [yet only T2?]).

At GZ, there were a few options but luckily the container was just visible. Only getting to it was going to be difficult. At least there was two of us, and I lifted the lighter one up for a go at it. But something failed in the process and we came crashing down (sans cache) and landed in the missionary position. Luckily no-one had a camera! After dusting each other off, we had to replan our strategy. Now WWMGD? (that's What would MacGyver Do to you uninitiated). Looking for inspiration I found a tool (no, not a Swiss Army Knife and no, not duct tape), and soon was able to complete our task. Returning the cache took a perfectly judged toss. Bingo.

All in all a fantastic time.

Thanks for the cache, XY Freddo.

(PS thanks for the stick)

This entry was edited by Malco! on Wednesday, 23 April 2014 at 00:12:03 UTC.

Events are always good for getting hints on those puzzle caches and others that have been nagging you for a while. Went out caching with locus cache, honeysucker and Walrus after the SAGA Awards event and grabbed a few more puzzles and multis. TFTC.

After the SAGA13 awards I found myself in a troupe with locus cache, firesafe and honeysucker attacking some nemesis caches for all of us. This was the first find for me, and I confess at the time I had not managed to solve this one despite a couple of attempts over the journey. Went home afterwards determined to nut this one out and after discovering a relevant 'key' the cache container was revealed. TFTC Freddo!

Owl has often meditated on the meaning of Liff. Now she has had occasion to explore the deeper meaning of Liff: It is good to have friends to point you in the right direction. A little splicing fixes any problems. It’s good to find a car park. You can always come back to cache another day if your physiology prevents a successful retrieval. No one notices if you walk through a public park with a step ladder over your shoulder. If she had grown that extra 2 inches Owl would have been a better cacher. A smilie is worth any potential embarrassing contortions.
There are no words.

IF A MAN KILLS A LION AT A ZOO, IS HE REALLY A HUNTER? I AM A HUNTER!!

I have been searching for the meaning of liff for some time. Douglas Adams confirmed the answer to liff, the universe and everything was 42. Monty Python made a movie about the Liff of Brian, closely followed by the Meaning of Liff. Even David Attenborough has presented about the Liff of Mammals.

None of this was useful in solving the code. Fortunately, I knew what the code was. With the benefits of my Y chromosome I was able to climb to the hide without assistance. Needed confirmation from the amphibious one as the fluorescent ones were working nearby. TFTC Freddo.

Have looked at this puzzle before, as it shows up as being very close to one of my occasional places of work, but never really paid it that much attention until .... it showed up as being within 160m of another location that I was interested in. Then it really got my attention!! Figured i knew roughly where it was but wasn't prepared to do a gene by gene search without assistance. So nothing for it but to solve the puzzle. Found a few interesting leads, and thought I had it beat at one stage, but never quite found the right gene sequencing tool. Until a tip-off at a recent night-time caching raid put me on the right track and the genome was revealed. Visited GZ yesterday, with my 5 year-old, 4'0" extension pole (aka Pirate Luke), and the mutation was quickly revealed on the expected chromosome. Thanks for another fun caching adventure Freddo. A least we had to get out of our car for this one!

At least my third attempt at this one, I solved this puzzle over two years ago but struggled to locate the container. This time, I spotted the cache straight away... how did I not see it before? I was able to get hold of this with some geogymnastics.

Found It!
Quite an easy puzzle if you try hard enough...
Now why on earth did you put a magnet in the cache??? Bloody sticks to everything.
TFTC

Could not see the container, and couldn't really get to where we needed to be without some sort of assistance. We spotted something that looked like a container from the other side on our return to the car.

We shall return.

Found this morning with e.gregory1. After solving this one a while ago we finally came here today with the right equipment and an easy access path to make the find. Thanks Freddo for the cache.

I managed to work this one out many months ago, but only after a lot of frustrating attempts and eventually a bit of a hint to send me in the right direction. Every time I went to visit GZ there seemed to be some sort of fencing or other obstacle in the way. A few weeks ago I noticed that the site was now clear and so this morning, before too many muggles would be about, EsromL and I finally got there to find the cache. Left Star GC. Thanks XY Freddo for the cache.

First stop on a day out with Froghoppin and a thankfully very agile drift kid. Quiet GZ early on a Sunday morning! Thanks Freddo for the challenge!!

done with the group and hair pulled out to many paths others got there first was a nightmare that got us all there

With a few nudges and hints from Google and some extra input from certain human brains, the site for the final DNA extraction was extrapolated.
Thankfully, some human beings have 'strength to provide impetus for another's high jump' genes in their DNA and so locus cache eventuated.
SL. TFTC Freddo

yeahhhh.. i'd like to call you a few names for this puzzle mate.. but will refrain myself.. LOL.. i wonder how many puzzle solvers out there.. start down one path.. and keep going.. deeper and deeper into the abyss before you start to wonder if you'll ever come back... then you see a path that takes you in the opposite direction.. do you take it??.. at this point you have to decide.. why not.. give it a go.. suddenly.. the path becomes clear and the answers reveal themselves.. aghhhhhhhhhhhhhhhhh damn you freddo!!!
great puzzle.. and having spoken to the cache owner recently (after having it solved).. he revealed another bit of information.. that really was staring me in the face!!...grrrrrr
excellent hide.. very nice indeed!

After spending a large amount on research dollars into breaking the code it was a passing remark at our annual beach function that led me to the breaking of the code, aftedr a mutations we finally had a working set of coords, in town today so we put the theory to the test and came up with a smiley, great puzzle TFTC freddo

Found with Mr Tardis as part of our clean up the Torrens caches bike ride. A hop from me, a push from Mr Tardis, and we were able to put the container within reach. I admit, I had to get a good postmortem nudge from Mr Tardis to solve this one, but with that tip, was able to solve the puzzle within much drama. First one like this for me, I really liked it. Thanks.

Started working on this puzzle about a week ago and did lots of googling and finding many interesting sites and information. I know much more about Deoxyribonucleic acid than I ever thought possible. However I had some leads but they didn't work out.

I put out a cry for help and CoC sugguested something I didn't try googling. I don't know that that site didn't come up in my hard work earlier. A quick solve and today was the day.

We were on bikes, but still too high, so ncnote21 did the American basketball thing and jumped up for the retrieve and replace. Mr Tardis must be getting older as I couldn't do that anymore.

Q: What is the fastest way to determine the sex of a chromosome?
A: Pull down its genes.

Q: What do you get when you cross donkey DNA with an onion?
A: A piece of ass that will bring tears to your eyes.

No problems working out the meaning of liff… unfortunately we didn’t realise we also needed a liff in order to reach the cache… until next time.

Tonight I collected a 5 star, 4 star, 3 star and 2 star puzzle. Strangely enough it was the 2 star that caused me the most grief. Having studied a little biochemistry in my days and knowing my Guanine from my Cytosine, I really over-complicated this puzzle. It wasn’t until one vital element (a Fritham?) in the cache description was pointed out that the solution fell into place.
Luckily I didn’t find a belper but I did end up with some kind of ampus or bauple on my clun

Come back - yep found the container so happy and signed the log. Thanks Freddo.

Good look at it but can't see any container. so DNF for me. Thanks.

Today we discovered the meaning lift. This was one of the more unorthodox ways of finding a puzzle cache we have had to date but were happy that a find was soon found and another smiley added and most vexxing puzzle put to bed.
TFTC

This puzzle has been haunting me for a long time. I mentioned it to another cacher while discussing some other puzzles, and he told me I was completely on the wrong track. I changed my tune, and solved the puzzle fairly easily. I was out for a ride with some friend today, and with a little bit of help, the cache was in hand
TNLN
thanks

Find # 1116
#1073 Found Without a GPS it’s easier.
Puzzle solved with some help from my friends but had to wait many months for the area to become accessible and the opportunity to take my ladder for a walk.
Thanks to XY Freddo for the cache and the challenge
Fine Elsewhere

What us the real meaning? Spending time with Mr T caching? It must be close. TNLNSL. Thanks Freddo.

Another puzzle found in company with the SE Qld Puzzle Solving Group - we spotted the cache easily, but sent someone a little more agile to retrieve it. We noticed the great looking old truck in the facility nearby. TFTC XY Freddo

We do have a copy of The Meaning of Liff at home somewhere, but couldn't find it, otherwise I would have provided a log of bizzare words )or meanings) which may not have provided a logical log.

Anyhow a word for the way the cache was retrieved, might have been handy, or perhaps that may have given it away. Who knows.

TFTC

Found with the SEQ puzzle solvers. Took a bit longer to find this cache than expected, but in the end the call came "got it!". TFTC and the puzzle.

Found as part of the SE Queensland puzzle solvers group raid on Adelaide. I didn't find the hint all that helpful We converged on GZ and took some time to find the cache. Some of the grooup 'road shotgun' above the searchers. TFTC XY Freddo

The penultimate find for the SEQ puzzle solvers during our loog weekend raid. After finding a way into GZ from where we had parked, we took a split level approach to see if we could spot the cache and guide the retrieval team onto the container... That was not necessary as it turned out and once in the right spot, the container was easily sighted... Retrieval was not quite so simple so we set Bedmaker onto the task... [^]

Always up for the challenge, he found himself an aid and off he went. We had a sticker in the log quickly thereafter and the cache was back in its den...

Cheers Freddo.

Found as a participant in the The SE Qld Puzzle Solvers Group Raid into Adelaide this weekend...

Thsi turned out to be the 2nd last cache of our weekend here in SA....

Puzzzle solved in our leadup work @ home

Team split into 2 trying to locate the cache.. spotting was the easy bit - retreval was a bit more complicated...

Once again bedmaker came to the fore & got his hand on the container..

TNLNSL

Thanks Freddo for the cache

#23 day 3 on SEQ puzzle solvers Adelaide trip. Loved the puzzle . Initially went after a red herring but found the right solution in time. Tricky tricky hide! Thankfully Loki wasn't attempting this one on her own or I don't think it would have been retrieved. Thanks Freddo [^]

A great deal of effort went into retrieving this one. Team Waldron, Lava 12 & Princess Consuela where all assisting abley, but it just came down to ingenuity & stupidity. You just need to get the ratios right...right [?]
Thanks Freddo

Found it with Team Waldron, thewhitedoggang and Princess Consuela. It was handy to have two tall men with us.
Thanks XY Freddo for the cache.

Dad had to make the retrieval while I stood behind him to stop him rolling into the river if he slipped.
Fun times!
TFTC FREDDO!

It was a team effort.

All of us did some part of the puzzle and/or the retrieval.

Just a good thing that Mike didn't get wet as he would have had to walk.

Nice puzzle.

TFTC

Eventually, after many years, the deed is done. I think the 2 stars is for very tall people.

No luck again and on credit on the mobile to get a hint.

Holy Mc Crap, that's a pretty busy fenced off/restricted and hard to get to place, especially at night. Didn't have the clue but I'm not sure it would have helped, muggle workers everywhere working on the Media Mike Tram extension project.

I quite enjoyed this puzzle and even more the retrieval of the cache itself.
I wasn't sure that I was up to the challenge but improvisation is my middle name and I got there.
Thanks to XY Freddo

Found with Acts2YouthGroup on an interstate trip. This was a joint effort to solve and especially to retrieve. Happily for him I am not that heavy! This cache could have almost been called the meaning of Lift? Thanks Freddo.

This was cache # 9 of 41 for the day, in the company of Alansee on our five day long weekend Adelaide caching Bonanza. The puzzle was not to hard once the correct tool was found, I have to say my shoulder suffered from this one for the rest of the day and the next one, thankfully Alansee was not to heavy and he soon had the cache in hand. I wondered if the smell coming from across the road was really the meaning of liff. My thanks to XY Freddo for the cache.

Enjoyed solving the puzzle. Found after the Adelaide Invasion Dinner in an area I didn't really want to be in, on my own at that time of night. Hoisted myself up to retrieve the cache, signed log, and returned it the same way. Thanks Freddo!

Cache is still in position. There is work in the area but it not affecting GZ at the moment.

Several trees have been removed from GZ recently (the sawdust is still there) and I suspect the cache may have gone with them.

One more great cache conquered today!

One of several puzzles I worked on before heading this way. Thanks!

Found today with a fair amount of help from O'Cholio. In fact he can take all the credit for solving the puzzle. It wan't til I had plenty of guidance I could solve it. Retrieving the cache however took a bit of teamwork so I don't feel so bad in logging this cache. TFTC. TNLN.

Only worked this one out yesterday, and was a bit apprehensive on hearing a ladder might be in order for the retrieval, but decided to give it a go without, anyway. Having JadedOptimist08 with me, I figured he could boost me (which he did!). Decided to hoist myself up into the hiding spot to put the cache back and ended up covered in dust and 'stuff' for my efforts. I must've been a sight when we made it to the pub lunch! A clever and original puzzle with a twist. TFTC and for the nudge

Wicked as only Freddo can be. Found with the help of Bruce's new extension . Thanks for the experience.

Well I finally got to go looking for this one tonight.
It's been a long struggle for me. I probably know enough about DNA, RNA, Polypeptide, nucleic and amino acids to last a life time.
Got a nudge in a direction my browsing hadn't taken. Probably so I would stop bugging everyone around me about it . I cant believe I hadn't come across the reference in all the browsing I did. Talk about bad luck.[B)]
So with a solution in hand I was off and racing.[^]

Thought by a map check that it was going to be an interesting retrieval and GZ sure lived up to that expectation.

CAACGTGTAGTAGGCGTTGTCATGCTGGGCGGAGTTATGGGACTTCTTCTGATGGTACTTCTGATGCTATAA
GCGGCGATGCTATAAGTTATGTAGGATGTTGAGATGCGTATGGCGCTTTACCTTGCGATGGGCGAAATGGAT
GGAGACCTTGGATAAGATGTTTCAATGGTTGAGCGTGTTATGTAGGGCTAAGCGCTGATGGAGCGTTACCTT
ATGGAGCGTCTGATGATACGTCTCACGTCATACCTTGTAATG
GACGTACTTCTTGGAATGTAGGATGTTGAGATGCTTGGATACTCAATGCGTGAAGTTCTTGTAATGCGTATG
GTTTAGCTTGGAGTTTCAATGGCTGATGGATAAGTTCTTATGGTCGTTGTATAAGACGACGCGCTTATGAGA
ATGGAGCGTCTGATGGTTGAGCTTATGCTCGGCGGAGTTCGTGATGGACTTGTAATGGATGGAATGGAGCGT
GGACTGGTGATGAACGCGCGTGTCGTTATGGTTGAGGGCGTCCTT
GGGCTTGTCGCCTCAATGGGGCTTGGCGGGGCGCTTATGGACGGCGATGGAGACATGGAGGGCGCTCTTATG
AGAATGGAGCGTCTGATGGTTGGCATGGCCCTTCTTGGGATGCTGGGCCTGGACGATGGAGACGTG

Signed the cache and took a lot of care putting it back were I got it from.

This is such a great Freddo cache I feel sorry for all the fans of the frog nation who are missing their chance to chalk this one up. If you are lucky it can really be easy.

Happily wandered away whistling an INXS tune.

Frovided acrobatic support for calumphing four. took bugmobile, left pet rock.

A bloke walked into the pub with a frog on his shoulder and the barman said, where'd you get him?
The frog said, it just started out as a pimple on the behind
Well that's what the scene looked liked at GZ, on a short night run with MustardKeenAs. Needed 12ft of grunt to get this one, and glad it is finally off the close to home list.
Quite a tranquil spot at night, with no muggles about.
Learnt more than I ever thought I needed to know about the strands of life. Visited Devilish Duck through.
TNLN, TFTC XY Freddo

Cheers
(11th of 18 planned frog caches for 2008 down now)

For people who have solved the puzzle the cache is still there. Might be time for some genetic modification.

another look with Self power this time but still didnt find

The biomedical scientist in me tried to translate the code into an ammino acid sequence to substitute in the corresponding letters. bah!! finally worked out the code but no luck finding the cache

It took a while, but we finally managed to find this one. Glad we had a few people here to retrieve the cache! Cheers Gav [1427]

Finally getting around to logging the record breaker Thanks!

Kiwi Cache Raid: #30 @ 02:26. One of our team members has all the attributes needed to be in a circus acrobatics team and he ably demontrated his abilities while looking for this cache Many thanks XY Freddo.,,,,,,,,,

2:26 a.m. This cache was found on our record-breaking attempt to find the most caches in a 24 hours period; we ended up finding 195 all up.

Thanks to all the cachers who placed these interesting caches in Adelaide.

I only wish we could have spent more time appreciating the locations that we visited on our whistle stop tour.

TNLN

Kiwi Cache Raid: #30 @ 02:26
Good idea for the puzzle.
Thanks to all Adelaide cachers for helping with our quest.
Cheers - M@

This one took us a while (in the context of a record attempt) but we got it all the same. Cache 30 for the evening 2:26am.

2.26am. Liked the puzzel....the cache took a little linger to find.
TNLNSL
TFTC
Cheers M [:O)] (675)

Spent a fair bit of time aloft until the elusive box was spotted.

TFTC